That is the general way you go from DNA, the "blueprint of life" to the functional stuff like proteins & enzymes. It goes from one sugar backbone with attached nucleosides, to another, to a protein product.
Reactive with respect to what?
Many proteins denature when they get too hot or, if pH or salinity changes, the proteins misfold irreversibly. DNA, with the two deoxyribose (a type of sugar) backbones, twists up, protecting the inside bases. This makes it stable at cold and hot temperatures, and a variety of chemical conditions. RNA, on the other hand, since it's not doublestranded (oh man, I forgot to mention that part) and has an extra oxygen that sticking out on it (the D in DNA is for DEOXYribose, as in, ribose without an oxygen). The oxygen adds to the reactivity. Working with RNA is hard, since it degrades much more quickly than DNA.
1.) How does it "coil"? It seems that if it's, say, laying out on my table, it would need some impetus to "coil".
RNA, all by itself, as these bases on the inside, which are attracted to each other- A to U, G to C. The letters are short for the bases (as opposed to an acid) that make them up. The coiling puts the RNA into a lower energy state.
2.) Given that there are only a finite number of base pairs, it seems to me that large chunks of the strand (I'm assuming it's a strand) look more or less like other large chunks of the strand. Given that the base pairs bind with some strength (van der Waals forces?),
Right. Hydrogen bonding. The same force that hold two DNA strands to make the double helix.
and that the strand of RNA itself has some tension, I can imagine a situation where one large chunk of base pairs could be out of place, and the interaction between conjugate bases would be too strong for the tension of the RNA to overcome. Does this happen?
I am not so familiar with RNA, mostly DNA, but yes, base (mis)pairing can lead to a number of things:
In DNA, similar matching sequences can slip, forming "bubbles" of DNA. This is a relatively common occurence, and can lead to large repetitive sites, called microsatellites, minisatellites, or
Short
Tandem
Tepeats. The differences are mostly with the size of the repeat, and the number of times it repeats (so a sequence ACGACGACGACG is an STR or microsatellite, while something like AAAAACGGGCAAAAACGGGC repeated 20 times is a minisatellite). These can actually cause disease, usually forms of mental retardation, such as Fragile X syndrome. But this is all at the DNA level, and actually have to be transcribed into RNA to cause problems (in most cases, there are always exceptions!).
Most of these STRs are silent- that is, they don't affect phenotype as far as we know. However, some STR sites can very tremendously from individual- DNA fingerprinting used in CSI looks at about 15 of these sites, I believe.
As for ribosomal RNA, the RNA that makes up part of the ribosome, the way the RNA coils is important to give it the right structure for ribosomes.
3.) Given the above, does it coil up the same way every time?
Given the same environmental conditions, it should. Of course, other parts of the body can be producing proteins or hormones that will interfere with the mRNA, and target it for degradation by sticking to it, for instance. This might be done if the body no longer needs that mRNA, and it being translated would cause problems or be costly (like translating heat shock proteins when the organism gets cold).
What if it coils up wrong?
Bad things. Some mRNAs may not be able to be read (translated), and produce non-function or poorly functioning proteins. Ribosomes will not be able to translate, effectively turning off the cell's protein factories. Transfer RNAs, or tRNA (haven't gone over this one yet), may move the wrong amino acids when reading mRNAs. A tRNA is a loop of base-pairing RNA with an amino acid attached. The complementary matches mRNA on a ribosome, and sticks the amino acid onto a growing chain of amino acids. More on tRNA later.
So the mRNA is just somehow a copy of the DNA, I guess?
Essentially. One base, the T on DNA, is replaced with U when transcribed to RNA. Ribose, the R of RNA, is a five carbon ring identical to Deoxyribose, D of DNA, except that there is an OH group on the 2' ring carbon. This means RNA, with an additional functional group, is more reactive than DNA. This leads to its ability to form structures (an important one being the tRNAs), as well as giving RNA to fold up and cleave itself.
What is the mechanism for "copying", and does it happen at regular intervals? If so, how does the "copier" know when to do its job? Behind all of this is some chemical reaction, like some intricate swiss watch made out of carbon, nitrogen and oxygen---is this correct? What makes the whole process go?
It's complicated. I will address this in a separate post, when I have more time.
Why would you want to modify it?
I've mentioned how RNA is reactive. mRNA is no exception. In order for it to make it to the ribosome unmolested, it needs a 5'cap, which is composed of methylguanine, I think. Basically the head gets a protective bit that contains some directory information, as well as poly-adenylation- the addition of more A's a the end, or tail of the molecule. The longer the tail, the longer it takes to degrade, since all the A's have to degrade first.
mRNA can also be edited after transcription, whether because of other concurrent events in the environment, or simply because that's how it works, or because we don't know yet. In some cases, imagine ordering a bunch of gizmos for your lab, but upon writing a long letter, you realize you need the more specific gizmotron. So you simply go back and add -tron to all your gizmos in the letter.
And what does this even mean?
Well, transcription (will have another post on it later) is the act of taking a strand of DNA (usually double stranded) and making an mRNA copy of it (usually single stranded). So post-transcription modification is stuff that occurs after transcription occurs- after you finished writing your letter ordering more gizmos. Both the 5'cap and addition of the poly-A tail can occur, and do occur, during transcription. They're not entirely post-transcriptional activities (though the poly adenylation mostly is).
I don't understand this at all. Why does it need to be translated? Isn't RNA/DNA a protein anyway?
DNA and RNA are simply sugar molecules carrying information in the form of nitrogenous bases. They are used by the ribosome to construct the building blocks of life: protein, from the... building blocks of proteins, amino acids. DNA & RNA are most definitely NOT proteins. Think of them as documents, if you anthropomorphizing the concept helps. A document can only describe. On it's own, you can' build a skyscraper from pictures. You need steel and men and machines.
And what does "translated" mean?
The "reading" of mRNA by the ribosome, the transfer of amino acids by tRNAs based on what the sequence of mRNA specifies, and the construction of the protein. So it's taking our blueprint for the skyscraper and building it.
And how does this "translation" take place?
I don't know as much about translation. I'll try to tackle it in another post, if someone doesn't get to it first.
Again, there is a chemical reaction taking place, which means that it is energetically favorable to store information in the protein, right?
Right.
And if this is the case, why doesn't the protein just copy the DNA directly?
Presumably because the reaction is only possible with the intermediate step (given biological conditions). Many, many, many organic syntheses require many, many, many intermediate steps to assemble the correct molecule without losing the side chains and R groups we want, while still keeping it cheap, or possible for that matter.
This tells me that genetic information of less than three base pairs long is irrelevant. That is, if there are three sequences that all give the same amino acid, why do we need three sequences? Given that nature typically doesn't do irrelevant things, why should this be the case?
The genetic material of organisms is mysterious stuff. We eukaryotes seem to have many redundant processes and a lot of "junk" DNA. DNA that we have no idea why it's there, and appears to do nothing. Though if you want an evolutionary explanation, it means that the 1 mutation per 1,000,000 bases rate (that is, in your genome, expect one mutation for every sequence of a million bases), few of them are actually going to change anything. Our longest chromosome has 226 million bases. We have 46 chromosomes. As you can see, we have a lot of errors.
This seems unlikely. How do all of these different molecules come in to play? And how does this happen in a finite time---naively there are 100! different ways for these different molecules to float by. So what gives?
No one really knows. It's a big mystery in molecular genetic. It seems EXTREMELY unlikely.