CriticalCat
Registered Member
Admittedly I'm very tired and have skimmed a bit, so smack me if I've overlooked something.
It seems to me that little to no distinction has been made between duplicate genes, introns, and "true" junk DNA; my understanding gained from my coursework was that junk DNA in its most specific sense is huge regions of short, repeating base pair sequences; not unidentified and apparently nonfunctional regions so much as codon gibberish. (Regions that read like CATAGCATAGCATAGCATAGCATAG or the like.) When I went to google to back up this assertion, the vast majority of links I got were to pages associated with new age philosophy, "biotheology", and Creationist sites, none of which I would be willing to cite as a credible source on molecular biology.
Duplicate genes happen often, especially in microrganisms, as duplicating an entire block is a relatively easy and harmless error to make during DNA replication. In a sense they constitute "backup" DNA for a short time, but paulsamuel is right in what they mostly do is sit around being slowly corrupted by genetic drift. Additionally, a mutation to a promoter region can render nonfunctional an entire pathway to slowly corrupt in this manner, if the pathway is no longer strictly necessary. Humans and some other primates share such a corrupted pathway for the biosynthesis of vitamin C; at some point in our evolutionary history we were eating enough fruit that mutations in this pathway no longer had any real consequence. The useless pathway is not exactly junk DNA, as it still codes for potentially functional proteins, but it no longer does anything. Duplicate genes seem to play a very important role in molecular evolution for bacteria. For my last summer job I spent all my time glued to a database of sequenced genomes studying the aromatic acid synthesis pathway of prokaryotes. Several of the catabolic genes of interest had sequences so closely related to other catabolic genes that I had to double-check and weed out the sequence-doubles by hand with every database search for certain genes. In addition, in the enteric bacteria the gene for the beginning of the pathway appeared to have diverged into three different versions that were maintained across species, possibly specific versions for each possible end product. (Tryptophan, tyrosine, and phenylalanine.)
Introns are sequences that are excised from the mRNA before it's sent on to produce the intended protein. No one's quite sure what's going on there, but aside from the "useless crap" theory it's been tentatively hypothesized that it has something to do with the process of protein splicing.
Does that help any?
It seems to me that little to no distinction has been made between duplicate genes, introns, and "true" junk DNA; my understanding gained from my coursework was that junk DNA in its most specific sense is huge regions of short, repeating base pair sequences; not unidentified and apparently nonfunctional regions so much as codon gibberish. (Regions that read like CATAGCATAGCATAGCATAGCATAG or the like.) When I went to google to back up this assertion, the vast majority of links I got were to pages associated with new age philosophy, "biotheology", and Creationist sites, none of which I would be willing to cite as a credible source on molecular biology.
Duplicate genes happen often, especially in microrganisms, as duplicating an entire block is a relatively easy and harmless error to make during DNA replication. In a sense they constitute "backup" DNA for a short time, but paulsamuel is right in what they mostly do is sit around being slowly corrupted by genetic drift. Additionally, a mutation to a promoter region can render nonfunctional an entire pathway to slowly corrupt in this manner, if the pathway is no longer strictly necessary. Humans and some other primates share such a corrupted pathway for the biosynthesis of vitamin C; at some point in our evolutionary history we were eating enough fruit that mutations in this pathway no longer had any real consequence. The useless pathway is not exactly junk DNA, as it still codes for potentially functional proteins, but it no longer does anything. Duplicate genes seem to play a very important role in molecular evolution for bacteria. For my last summer job I spent all my time glued to a database of sequenced genomes studying the aromatic acid synthesis pathway of prokaryotes. Several of the catabolic genes of interest had sequences so closely related to other catabolic genes that I had to double-check and weed out the sequence-doubles by hand with every database search for certain genes. In addition, in the enteric bacteria the gene for the beginning of the pathway appeared to have diverged into three different versions that were maintained across species, possibly specific versions for each possible end product. (Tryptophan, tyrosine, and phenylalanine.)
Introns are sequences that are excised from the mRNA before it's sent on to produce the intended protein. No one's quite sure what's going on there, but aside from the "useless crap" theory it's been tentatively hypothesized that it has something to do with the process of protein splicing.
Does that help any?